 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SCFaV |  |
|||
| PKB-number: | PKB272 |
| Definition: | A 3'-terminal pseudoknot in SCFaV |
| Organism: | strawberry chlorotic fleck associated virus |
| Abbreviation: | SCFaV |
| RNA type: | Viral 3 UTR |
| Keywords: | Closteroviridae; closterovirus |
| EMBL number: | DQ860839 |
| Submitted by: | A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Sequence comparison; |
| References: |
[1] Tzanetakis I.E. et al. (2007). Virus Res. 124:88-94.
[2] Livieratos I.C. et al. (2004). J. Gen. Virol. 85:2065-2075. |
| Comment: | Similar pseudoknots are predicted in criniviruses and some of the closteroviruses and ampeloviruses [1,2]. |
| Stem sizes: Loop sizes: |
8 6 28 0 5 |
| Position Paired: | 16975-16982; 17017-17024 16988-16992; 17006-17010 16994-16997; 17002-17005 17011-17016; 17030-17035 |
| Bracket view of structure: |
16980 16990 17000 17010 17020 17030
# 456789|123456789|123456789|123456789|123456789|123456789|123456789
$ 16974 ACUGUGAUUAUAAAAGUGGAGUACUAAAGUACCCACUACCUUUAAUCACAGACAAUAAAGGUCCAU=17039
% 16974 :((((((((:::::(((((:((((::::)))))))))[[[[[[)))))))):::::]]]]]]::::