 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TEV_PK3 |  |
|||
| PKB-number: | PKB279 |
| Definition: | The 5'-leader pseudoknot PK3 of TEV |
| Organism: | tobacco etch virus |
| Abbreviation: | TEV_PK3 |
| RNA type: | Viral 5 UTR |
| Keywords: | Potyviridae; cap-independent translation |
| EMBL number: | NC_001555 |
| Submitted by: | A.P. Gultyaev ( a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Mutagenesis; Structure probing; |
| References: | [1] Zeenko V. & Gallie D.R. (2005). J. Biol. Chem. 280:26813-26824. |
| Comment: | |
| Stem sizes: Loop sizes: |
5 3 2 0 1 |
| Position Paired: | 106-110; 116-120 113-115; 122-124 |
| Bracket view of structure: |
110 120
# 56789|123456789|12345
$ 105 CAAUUUUCUGAAAAUUUUCAC=125
% 105 :(((((::[[[))))):]]]: