Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Agam_1_1

PKB-number: PKB327
Definition: HDV-like ribozyme
Organism: Anopheles gambiae
Abbreviation: drz_Agam_1_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006878
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 8 3 2
6 0 1 4 0
Position Paired:
1 -7 ; 35-41
14-21; 75-82
22-24; 32-34
26-27; 42-43
46-51; 62-67
53-54; 59-60
Bracket view of structure:
            10        20        30        40        50        60        70        80
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|123456789|12
$ 1 GGCUGACAAAAUCCUUUCCCAACCUCCACGUGGUGUCGGCUGGAUAAUGCAUUAGAAAUGUUGCAUUUACCAACUGGGAAGG=82
% 1 (((((((::::::[[[[[[[[(((:[[::::))))))))))]]::((((((:((::::)):)))))):::::::]]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00327.HTML