Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
drz_Dpap_1

PKB-number: PKB341
Definition: HDV-like ribozyme
Organism: Diplonema papillatum
Abbreviation: drz_Dpap_1
RNA type: Ribozymes
Keywords: self-cleavage; hepatitis delta virus ribozyme; HDV-like ribozyme
EMBL number: BK006896
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison,ribozyme activity
References: [1] Webb CH, Riccitelli NJ, Ruminski DJ & Luptak A (2009). Science 326:953.
Stem sizes:
Loop sizes:
7 8 3 2
6 0 1 4 0
Position Paired:
1 -7 ; 36-42
14-16; 74-76
18-22; 69-73
23-25; 33-35
27-28; 43-44
48-52; 58-62
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|123456
$ 1 GAGGGACAAGAAUCUGACCUGCACCUCCUCGUGGUGUCCCUCGGAAACGUGCUCAACGCGCGGCCGACGCAGGCAG=76
% 1 (((((((::::::[[[:[[[[[(((:[[::::))))))))))]]:::(((((:::::)))))::::::]]]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2010-1-18 PKB00341.HTML