 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
MVEV |
 |
|||
| PKB-number: | PKB349 |
| Definition: | NS1' ribosomal frameshift site of Murray Valley encephalitis virus |
| Organism: | Murray Valley encephalitis virus |
| Abbreviation: | MVEV |
| RNA type: | Viral Frameshift |
| Keywords: | Flaviviridae; ribosomal frameshifting |
| EMBL number: | NC_000943 |
| Submitted by: | A.P. Gultyaev (goultiaevap2@chem.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison |
| References: |
[1] Firth AE & Atkins JF (2009). Virol. J. 6:14.
[2] Melian EB et al. (2010). J. Virol. 84:1641-1647. |
| Comment: | |
| Stem sizes: Loop sizes: |
11 7 7 2 16 |
| Position Paired: | 3563-3573; 3590-3600 |
| Bracket view of structure: |
3560 3570 3580 3590 3600 3610
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 3551 UCCUUUUCAGUUAGGCCUUCUGGUGAUGUUUCUGGCCACCCAGGAGGUCUUGAGGAAGAG=3610
% 3551 ::::::::::::(((((((((((:::::::[[[[[[[::)))))))))))::::::::::
3620 3630
# 123456789|123456789|
$ 3611 GUGGACGGCCAGACUUACUC=3630
% 3611 ::::::]]]]]]]:::::::