 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
K.lac_telo |
 |
|||
| PKB-number: | PKB360 |
| Definition: | Pseudoknot of telomerase RNA of K. lactis |
| Organism: | Kluyveromyces lactis |
| Abbreviation: | K.lac_telo |
| RNA type: | Others |
| Keywords: | telomerase |
| EMBL number: | U31465 |
| Submitted by: | A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison |
| References: |
[1] Tzfati Y et al. (2003). Genes Dev. 17:1779-1788.
[2] Shefer K et al. (2007). Mol. Cell. Biol. 27:2130-2143. |
| Stem sizes: Loop sizes: |
5 12 6 0 72 |
| Position Paired: | 1530-1534; 1553-1557 |
| Bracket view of structure: |
1530 1540 1550 1560 1570 1580 1590
# 123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1521 UAUUCGGUAGGUUUCUUUUUAGUGAUUUUUCCAAACCCAUUCUUCUCUUCGUUAGUAUAUUUGACUCGGU=1590
% 1521 :::::::::(((((::::::[[[[[[[[[[[[))))):::::::::::::::::::::::::::::::::
1600 1610 1620 1630 1640 1650
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 1591 UCUAUUUCAAUGUGUCGCAUUGAAAUAGAAAUCCUUUGUGCAUAAAAUCAUUUACCUCAA=1650
% 1591 :::::::::::::::::::::::::::::::::::::::]]]:]]]]]]]]]::::::::