 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_RydC |
 |
|||
| PKB-number: | PKB374 |
| Definition: | RydC sRNA pseudoknot of Escherichia coli |
| Organism: | Escherichia coli K-12 |
| Abbreviation: | Ec_RydC |
| RNA type: | Others |
| Keywords: | small RNA (sRNA); biofilm production; translation inhibition; antisense RNA |
| EMBL number: | NC_000913 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Mutagenesis,Sequence comparison,Structure probing |
| References: |
[1] Antal M. et al. (2005) J. Biol. Chem. 280:7901-7908.
[2] Bordeau V. & Felden B. (2014). Nucleic Acids Res. 42:4682-4696. |
| Comment: | The shown region corresponds to the complement (1491443..1491506) from NCBI Reference Sequence NC_000913. |
| Stem sizes: Loop sizes: |
7 9 6 1 7 |
| Position Paired: | 12-18; 35-41 |
| Bracket view of structure: |
10 20 30 40 50 60
# 123456789|123456789|123456789|123456789|123456789|123456789|1234
$ 1 CUUCCGAUGUAGACCCGUAUUCUUCGCCUGUACCACGGGUCGGUUUUAGUACAGGCGUUUUCUU=64
% 1 :::::::::::(((((((::::::[[[[[[[[[:))))))):::::::]]]]]]]]]:::::::