|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
ydaO_riboswitch_Bs |
|
|||
| PKB-number: | PKB381 |
| Definition: | ydaO riboswitch |
| Organism: | Bacillus subtilis |
| Abbreviation: | ydaO_riboswitch_Bs |
| RNA type: | Aptamers |
| Keywords: | ydaO; riboswitch; c-di-AMP |
| EMBL number: | CP009796 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Crystal structure,Sequence comparison |
| References: |
[1] Block K.F. et al. (2010). J. Bacteriol. 192:3983-3989.
[2] Nelson JW et al. Nature Chem. Biol. 2013 9:834-839. [3] Gao A. & Serganov A. (2014). Nature Chem. Biol. 10:787-792. |
| Comment: | The ydaO riboswitch motif is common in bacteria. The sequence given here corresponds to the region 444631-444770 of complete genome of Bacillus subtilis strain SG6 (Accession CP009796.1) |
| Stem sizes: Loop sizes: |
27 6 3 3 2 |
| Position Paired: | 8 -9 ; 130-131 |
| Bracket view of structure: |
10 20 30 40 50 60 70 # 123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345 $ 1 GAAAACAAAUCGCUUAAUCUGAAAUCAGAGCGGGGGACCCAAUAGAACGGCUUUUUGCCGUUGGGGUGAAUCCUU=75 % 1 :::::::((:(((((::((((::::))))(((((((::((:::::((((((:::::))))))((((((::((((: 80 90 100 110 120 130 140 # 6789|123456789|123456789|123456789|123456789|123456789|123456789| $ 76 UUUAGGUAGGGCUAACUCUCAUAUGCCCGAAUCCGUCAGCUAACCUCGUAAGCGUUCGUGAGAGG=140 % 76 :::))))(((((:::[[[[[[:::))))))))))::):))::))))))))))))))::]]]]]]: