|
|
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
|
|
PDV3 |
|
|||
| PKB-number: | PKB398 |
| Definition: | tRNA-like structure pseudoknot of RNA3 |
| Organism: | Prune dwarf virus |
| Abbreviation: | PDV3 |
| RNA type: | Viral tRNA-like |
| Keywords: | Bromoviridae; Ilarvirus |
| EMBL number: | NC_008038 |
| Submitted by: | A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1]Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83. |
| Stem sizes: Loop sizes: |
15 6 1 1 51 |
| Position Paired: | 2028-2035; 2064-2071 |
| Bracket view of structure: |
2030 2040 2050 2060 2070 2080 2090 # 89|123456789|123456789|123456789|123456789|123456789|123456789| $ 2028 GAUGAAAAUGCCCAUUGUAUCCUGAAUGGAUGACACUUUUCAUUGCCUACAAAUUUUGUACAU=2090 % 2028 ((((((((((:(((((:[[[[[[:)))))::::)):)))))))):::(((((:::)))))::: 2100 2110 2120 # 123456789|123456789|123456789|123456789 $ 2091 GCCCUCACCGUAAGGUGAGGAUGCCCCUUUAAGGGAUGC=2129 % 2091 ::(((((((::::)))))))::::::::::::]]]]]]: