 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
FIV |  |
|||
| PKB-number: | PKB4 |
| Definition: | Gag-pol ribosomal frameshift site of Feline Immunodeficiency Virus |
| Organism: | Feline Immunodeficiency Virus |
| Abbreviation: | FIV |
| RNA type: | Viral ribosomal frameshifting |
| Keywords: | retroviridae; ribosomal frameshift; gag-pol |
| EMBL number: | M25381 |
| Submitted by: | J. Ng ( JackTown@Hotmail.com) |
| Supported by: | Sequence comparison |
| References: |
[1] ten Dam E., Pleij C.W.A., & Bosch L.(1990). Virus Genes 4, 121-136.
[2] Talbot et al.(1989). Proc.Natl.Acad.Sci.USA 86, 5743-5747. [3] Phillips,T.R. et al. (1990). J.Virol. 64, 4605-4613. |
| Comment: | The sequence below is given for so-called Petaluma isolate [2]. In the PPR-isolate [3], the A at position 1921 is substituted by G (EMBL accession number M36968). |
| Stem sizes: Loop sizes: |
5 6 2 0 11 |
| Position Paired: | 1893-1897; 1906-1910 1900-1905; 1922-1927 |
| Bracket view of structure: |
1880 1890 1900 1910 1920
# 89|123456789|123456789|123456789|123456789|1234567
$ 1878 GGGAAACUGGAAGGCGGGGCGAGCUGCAGCCCCAGUGAAUCAAAUGCAGC=1927
% 1878 :::::::::::::::[[[[[::((((((]]]]]:::::::::::))))))