 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TYMV |  |
|||
| PKB-number: | PKB5 |
| Definition: | tRNA-like structure from turnip yellow mosaic virus |
| Organism: | turnip yellow mosaic virus |
| Abbreviation: | TYMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tymoviruses; aminoacylation; RNA 3'end |
| EMBL number: | X16378 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | NMR; Structure probing; Sequence comparison; Mutagenesis |
| References: |
[1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem 1991, 201:303-324
[2] Mans RMW et al. J.Mol.Biol. 1992, 223:221-232 [3] Kolk MH et al. Science 1998, 280:434-438 |
| Comment: | This is the representative structure for a group of pseudoknots, that was extensively studied by several methods. |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 6293-6295; 6305-6307 6300-6304; 6311-6315 |
| Bracket view of structure: |
6280 6290 6300 6310
# 89|123456789|123456789|123456789|12345678
$ 6278 CGGGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACC=6318
% 6278 :::::::::::::::(((::::[[[[[))):::]]]]]:::