 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
EMV |  |
|||
| PKB-number: | PKB15 |
| Definition: | tRNA-like structure 3'end pseudoknot of eggplant mosaic virus |
| Organism: | eggplant mosaic virus |
| Abbreviation: | EMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tymoviruses; RNA 3'end |
| EMBL number: | J04374 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324 |
| Stem sizes: Loop sizes: |
3 6 2 0 3 |
| Position Paired: | 6305-6307; 6316-6318 6310-6315; 6322-6327 |
| Bracket view of structure: |
6300 6310 6320 6330
# 123456789|123456789|123456789|123456789|1
$ 6291 UGGGUGCGACUCCCCCCCCUCCCGUGGGUCAACGGGAACCA=6331
% 6291 ::::::::::::::(((::[[[[[[))):::]]]]]]::::