 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
OMV |  |
|||
| PKB-number: | PKB16 |
| Definition: | tRNA-like structure 3'end pseudoknot of okra mosaic virus |
| Organism: | okra mosaic virus |
| Abbreviation: | OMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tymoviruses; RNA 3'end |
| EMBL number: | AF035202 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Stem sizes: Loop sizes: |
3 6 3 0 3 |
| Position Paired: | 655-657; 667-669 661-666; 673-678 |
| Bracket view of structure: |
640 650 660 670 680
# |123456789|123456789|123456789|123456789|1
$ 640 GGGGUGCAACUCCCCCGCCCAUCUCGAGCGUCAUCGAGACCA=681
% 640 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::