 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CcTMV |  |
|||
| PKB-number: | PKB17 |
| Definition: | tRNA-like structure 3'end pseudoknot of cowpea strain of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | CcTMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end; aminoacylation |
| EMBL number: | J02413 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324 |
| Comment: |
The 3'end of this tobamoviral RNA has structural similarity to the
tymoviral structures and, in contrast to histidine-accepting tobamoviruses, is
charged with valine.
This virus is also called: sunhemp mosaic virus (SHMV). |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 1774-1776; 1786-1788 1781-1785; 1792-1796 |
| Bracket view of structure: |
1760 1770 1780 1790 1800
# 9|123456789|123456789|123456789|123456789|
$ 1759 GGGGAGCAUUACCCCCCCAAAACCCUGGGGAUACAGGGCCCA=1800
% 1759 :::::::::::::::(((::::[[[[[))):::]]]]]::::