 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMV |  |
|||
| PKB-number: | PKB18 |
| Definition: | tRNA-like structure 3'end pseudoknot of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | TMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | J02415 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] Rietveld K et al., EMBO J.1984, 3:2613-2619.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Comment: |
This is the most extensively studied representative structure from
tobamoviruses.
The sequence is given for the so-called "strain vulgare". |
| Stem sizes: Loop sizes: |
3 4 3 0 2 |
| Position Paired: | 6373-6375; 6383-6385 6379-6382; 6388-6391 |
| Bracket view of structure: |
6360 6370 6380 6390
# 89|123456789|123456789|123456789|12345
$ 6358 GGGGUUCGAAUCCCCCCGUUACCCCCGGUAGGGGCCCA=6395
% 6358 :::::::::::::::(((:::[[[[)))::]]]]::::