 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
STMV |  |
|||
| PKB-number: | PKB22 |
| Definition: | tRNA-like structure 3'end pseudoknot of satellite tobacco mosaic virus |
| Organism: | satellite tobacco mosaic virus |
| Abbreviation: | STMV |
| RNA type: | Viral tRNA-like |
| Keywords: | satellite virus; RNA 3'end; aminoacylation |
| EMBL number: | M25782 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Gultyaev AP, van Batenburg E, Pleij CWA.
J.Gen.Virol. 1994, 75:2851-2856.
[2] Felden B, Florentz C, McPherson A, Giege R. Nucleic Acids Res. 1994, 22:2882-2886. |
| Stem sizes: Loop sizes: |
3 4 3 0 3 |
| Position Paired: | 1035-1037; 1045-1047 1041-1044; 1051-1054 |
| Bracket view of structure: |
1020 1030 1040 1050
# |123456789|123456789|123456789|12345678
$ 1020 GGGGUUCGAAUCCCUCCCUAACCGCGGGUAAGCGGCCCA=1058
% 1020 :::::::::::::::(((:::[[[[))):::]]]]::::