 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMGMV |  |
|||
| PKB-number: | PKB23 |
| Definition: | tRNA-like structure 3'end pseudoknot of tobacco mild green mosaic virus |
| Organism: | tobacco mild green mosaic virus |
| Abbreviation: | TMGMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | M34077 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] Garcia-Arenal F. Virology 1988, 167:201-206.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem. 1991, 201:303-324. |
| Comment: | The nucleotide G-6335 seems to be misprinted in the entry (M34077) of the EMBL database as C, while this is G in the original article [1], which is consistent with a model of tRNA-like structure. |
| Stem sizes: Loop sizes: |
3 4 3 0 2 |
| Position Paired: | 6333-6335; 6343-6345 6339-6342; 6348-6351 |
| Bracket view of structure: |
6320 6330 6340 6350
# 89|123456789|123456789|123456789|12345
$ 6318 GAGGUUCGAAUCCUCCCGUAACCGCCGGUAGCGGCCCA=6355
% 6318 :::::::::::::::(((:::[[[[)))::]]]]::::