 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PaMMV |  |
|||
| PKB-number: | PKB24 |
| Definition: | tRNA-like structure 3'end pseudoknot of paprika mild mottle virus |
| Organism: | paprika mild mottle virus |
| Abbreviation: | PaMMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | X72586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Garcia-Luque I et al. Arch.Virol.1993, 131:75-88.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Comment: | Initially the virus was termed as P11 strain or Dutch isolate of pepper mild mottle virus (PMMV), but the term for a new virus paprika mild mottle virus (PaMMV) was proposed [1] on the basis of sequence comparisons. |
| Stem sizes: Loop sizes: |
3 4 3 0 3 |
| Position Paired: | 817-819; 827-829 823-826; 833-836 |
| Bracket view of structure: |
810 820 830 840
# 23456789|123456789|123456789|123456789|
$ 802 GGGGUUCGAAUCCCCCCUUUACCCCGGGUAUGGGGCCCA=840
% 802 :::::::::::::::(((:::[[[[))):::]]]]::::