| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| ORMV | |||||
| PKB-number: | PKB26 |
| Definition: | tRNA-like structure 3'end pseudoknot of oilseed rape mosaic virus |
| Organism: | oilseed rape mosaic virus |
| Abbreviation: | ORMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | U30944 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Aguilar I. et al. Plant Mol. Biol. 1996, 30:191-197.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Comment: | Initially this tobamovirus was called youcai mosaic virus, later as chinese rape mosaic virus; finally it was suggested [1] to change the name to oilseed rape mosaic virus (ORMV). |
| Stem sizes: Loop sizes: |
3 4 2 0 2 |
| Position Paired: | 6282-6284; 6291-6293 6287-6290; 6296-6299 |
| Bracket view of structure: |
6270 6280 6290 6300
# 789|123456789|123456789|123456789|123
$ 6267 GAGGUUCGAAUCCUCCCUAACCCCGGGUAGGGGCCCA=6303
% 6267 :::::::::::::::(((::[[[[)))::]]]]::::