 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PMMV-S |  |
|||
| PKB-number: | PKB27 |
| Definition: | tRNA-like structure 3'end pseudoknot of pepper mild mottle virus, Spanish isolate |
| Organism: | pepper mild mottle virus |
| Abbreviation: | PMMV-S |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | M81413 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Avila-Rincon MJ et al. J.Gen.Virol.1989, 70:3025-3031.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Stem sizes: Loop sizes: |
3 4 3 0 2 |
| Position Paired: | 6335-6337; 6345-6347 6341-6344; 6350-6353 |
| Bracket view of structure: |
6320 6330 6340 6350
# |123456789|123456789|123456789|1234567
$ 6320 GGGGUUCGAAUCCCCCCCGAACCGCGGGUAGCGGCCCA=6357
% 6320 :::::::::::::::(((:::[[[[)))::]]]]::::