 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
ORSV-S1 |  |
|||
| PKB-number: | PKB28 |
| Definition: | tRNA-like structure 3'end pseudoknot of odontoglossum ringspot virus, Singapore isolate |
| Organism: | odontoglossum ringspot virus |
| Abbreviation: | ORSV-S1 |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | U34586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Chng CG et al., Gene 1996, 171:155-161.
[2] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Stem sizes: Loop sizes: |
3 4 2 0 2 |
| Position Paired: | 6588-6590; 6597-6599 6593-6596; 6602-6605 |
| Bracket view of structure: |
6580 6590 6600
# 3456789|123456789|123456789|123456789
$ 6573 GGGAUUCGAAUUCCCCCUUACCUCGGGUAGAGGCCCA=6609
% 6573 :::::::::::::::(((::[[[[)))::]]]]::::