 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SBWMV1 |  |
|||
| PKB-number: | PKB30 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA1 of soil-borne wheat mosaic virus |
| Organism: | soil-borne wheat mosaic virus |
| Abbreviation: | SBWMV1 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end; aminoacylation |
| EMBL number: | L07937 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Shirako Y, Wilson TM. Virology 1993, 195:16-32.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 7074-7076; 7085-7087 7080-7084; 7091-7095 |
| Bracket view of structure: |
7060 7070 7080 7090
# 9|123456789|123456789|123456789|123456789
$ 7059 GGGGUUCAAAUCCCCCCCGAACCGGAGGGUUAUCCGGCCCA=7099
% 7059 :::::::::::::::(((:::[[[[[))):::]]]]]::::