 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SBWMV2 |  |
|||
| PKB-number: | PKB31 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA2 of soil-borne wheat mosaic virus |
| Organism: | soil-borne wheat mosaic virus |
| Abbreviation: | SBWMV2 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end; aminoacylation |
| EMBL number: | X81639 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Shirako Y, Wilson TM. Virology 1993, 195:16-32.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 3568-3570; 3579-3581 3574-3578; 3585-3589 |
| Bracket view of structure: |
3560 3570 3580 3590
# 3456789|123456789|123456789|123456789|12
$ 3553 GGGGUUCAAUUCCCCCCCCAUCCGGAGGGUUAUCCGGCCC=3592
% 3553 :::::::::::::::(((:::[[[[[))):::]]]]]:::