 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PMTV2 |  |
|||
| PKB-number: | PKB32 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA2 of potato mop-top virus |
| Organism: | potato mop-top virus |
| Abbreviation: | PMTV2 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end; aminoacylation |
| EMBL number: | D30753 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Scott KP, Kashiwasaki S, Reavy B, Harrison BD.
J.Gen.Virol. 1994, 75:3561-3568.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178. |
| Stem sizes: Loop sizes: |
3 6 2 0 2 |
| Position Paired: | 2938-2940; 2949-2951 2943-2948; 2954-2959 |
| Bracket view of structure: |
2930 2940 2950 2960
# 56789|123456789|123456789|123456789|12
$ 2925 GGGUGCAACUCCCCCCCCCUUGGAGGGUAUCCAAGACC=2962
% 2925 :::::::::::::(((::[[[[[[)))::]]]]]]:::