| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| BSBV1 | |||||
| PKB-number: | PKB36 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA 1 of beet soil-borne virus |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV1 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end |
| EMBL number: | Z97873 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Koenig R., Loss S. J.Gen.Virol.1997, 78:3161-3165.
[2] Koenig et al. J.Gen.Virol. 1998, 2027-2036. |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 5809-5811; 5821-5823 5816-5820; 5827-5831 |
| Bracket view of structure: |
5800 5810 5820 5830
# 456789|123456789|123456789|123456789|1234
$ 5794 GGGGUGCAAAUCCCCCCCUUUACUUGAGGGAAAUCAAGCCC=5834
% 5794 :::::::::::::::(((::::[[[[[))):::]]]]]:::