 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
IPCV1 |  |
|||
| PKB-number: | PKB35 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA-1 of Indian peanut clump virus |
| Organism: | Indian peanut clump virus |
| Abbreviation: | IPCV1 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end; aminoacylation |
| EMBL number: | X99149 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Miller JS et al. Arch.Virol. 1996, 141:2301-2312.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178. |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 5815-5817; 5827-5829 5822-5826; 5833-5837 |
| Bracket view of structure: |
5810 5820 5830 5840
# 23456789|123456789|123456789|123456789|1
$ 5802 GGUGCAAAUCCCCCGCCGAUACGGAGCGAUAUCCGUCCCA=5841
% 5802 :::::::::::::(((::::[[[[[))):::]]]]]::::