 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PCV2 |  |
|||
| PKB-number: | PKB34 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA2 of peanut clump virus |
| Organism: | peanut clump virus |
| Abbreviation: | PCV2 |
| RNA type: | Viral tRNA-like |
| Keywords: | furovirus; RNA 3'end; aminoacylation |
| EMBL number: | L07269 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; aminoacylation assays |
| References: |
[1] Manohar SK et al., Virology 1993, 195:33-41.
[2] Goodwin JB, Dreher TW. Virology 1998, 246:170-178. |
| Stem sizes: Loop sizes: |
3 5 4 0 3 |
| Position Paired: | 4478-4480; 4490-4492 4485-4489; 4496-4500 |
| Bracket view of structure: |
4470 4480 4490 4500
# 56789|123456789|123456789|123456789|1234
$ 4465 GGUGCAAAUCCCCCGCUGAAACGGAGCGAUAUCCGUCCCA=4504
% 4465 :::::::::::::(((::::[[[[[))):::]]]]]::::