 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ1 |  |
|||
| PKB-number: | PKB39 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA 1 of beet virus Q |
| Organism: | beet virus Q |
| Abbreviation: | BVQ1 |
| RNA type: | Viral tRNA-like |
| Keywords: | pomovirus; RNA 3'end |
| EMBL number: | AJ223596 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. J.Gen.Virol.1998, 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 5978-5980; 5989-5991 5984-5988; 5995-5999 |
| Bracket view of structure: |
5970 5980 5990 6000
# 3456789|123456789|123456789|123456789|123
$ 5963 GGGGUGCAAAUCCCCCCCUAACUUGAGGGAAAUCAAGCCCC=6003
% 5963 :::::::::::::::(((:::[[[[[))):::]]]]]::::