 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ2 |  |
|||
| PKB-number: | PKB40 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA 2 of beet virus Q |
| Organism: | beet virus Q |
| Abbreviation: | BVQ2 |
| RNA type: | Viral tRNA-like |
| Keywords: | pomovirus; RNA 3'end |
| EMBL number: | AJ223597 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. J.Gen.Virol. 1998, 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 2889-2891; 2900-2902 2895-2899; 2906-2910 |
| Bracket view of structure: |
2880 2890 2900 2910
# 456789|123456789|123456789|123456789|123
$ 2874 GGGGUGCAAAUCCCCCCCUAACUUGAGGGAAAUCAAGCCC=2913
% 2874 :::::::::::::::(((:::[[[[[))):::]]]]]:::