 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ3 |  |
|||
| PKB-number: | PKB41 |
| Definition: | tRNA-like structure 3'end pseudoknot of RNA 3 of beet virus Q |
| Organism: | beet virus Q |
| Abbreviation: | BVQ3 |
| RNA type: | Viral tRNA-like |
| Keywords: | pomovirus; RNA 3'end |
| EMBL number: | AJ223598 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. J.Gen.Virol. 1998, 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 5 3 0 3 |
| Position Paired: | 2504-2506; 2515-2517 2510-2514; 2521-2525 |
| Bracket view of structure: |
2490 2500 2510 2520
# 9|123456789|123456789|123456789|123456789
$ 2489 GGGGUGCAAAUCCCCCCCUAACUUGAGGGAAAUCAAGCCCC=2529
% 2489 :::::::::::::::(((:::[[[[[))):::]]]]]::::