 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_PK2 |  |
|||
| PKB-number: | PKB50 |
| Definition: | Pseudoknot PK2 of E.coli tmRNA |
| Organism: | E.coli |
| Abbreviation: | Ec_PK2 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA |
| EMBL number: | U68074 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103. [3] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [4] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. |
| Stem sizes: Loop sizes: |
14 5 3 0 10 |
| Position Paired: | 138-144; 175-181 145-148; 167-170 151-153; 162-164 157-161; 192-196 |
| Bracket view of structure: |
140 150 160 170 180 190
# 89|123456789|123456789|123456789|123456789|123456789|123456
$ 138 CCUCUCUCCCUAGCCUCCGCUCUUAGGACGGGGAUCAAGAGAGGUCAAACCCAAAAGAG=196
% 138 (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]]