Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
Ec_PK3 |
PKB-number: | PKB51 |
Definition: | Pseudoknot PK3 of E.coli tmRNA |
Organism: | E.coli |
Abbreviation: | Ec_PK3 |
RNA type: | tmRNA |
Keywords: | trans-translation; peptide tagging; tmRNA |
EMBL number: | U68074 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison; Structure probing |
References: |
[1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103. [3] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [4] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. |
Stem sizes: Loop sizes: |
9 5 1 0 11 |
Position Paired: | 200-203; 226-229 207-211; 218-222 213-217; 241-245 |
Bracket view of structure: |
200 210 220 230 240 # |123456789|123456789|123456789|123456789|12345 $ 200 GCGUGGAAGCCCUGCCUGGGGUUGAAGCGUUAAAACUUAAUCAGGC=245 % 200 ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]]