 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_PK3 |  |
|||
| PKB-number: | PKB51 |
| Definition: | Pseudoknot PK3 of E.coli tmRNA |
| Organism: | E.coli |
| Abbreviation: | Ec_PK3 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA |
| EMBL number: | U68074 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103. [3] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [4] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. |
| Stem sizes: Loop sizes: |
9 5 1 0 11 |
| Position Paired: | 200-203; 226-229 207-211; 218-222 213-217; 241-245 |
| Bracket view of structure: |
200 210 220 230 240
# |123456789|123456789|123456789|123456789|12345
$ 200 GCGUGGAAGCCCUGCCUGGGGUUGAAGCGUUAAAACUUAAUCAGGC=245
% 200 ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]]