 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMV_PKbulge |  |
|||
| PKB-number: | PKB57 |
| Definition: | tRNA-like structure bulge pseudoknot of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | TMV_PKbulge |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | J02415 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing; 3D-modelling |
| References: |
[1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur.J.Biochem. 201:303-324. [3] Felden B. et al. (1996). RNA 2:201-212. |
| Comment: | This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare". |
| Stem sizes: Loop sizes: |
7 4 4 34 7 |
| Position Paired: | 6291-6297; 6340-6346 6306-6309; 6336-6339 6315-6322; 6328-6335 6302-6305; 6354-6357 |
| Bracket view of structure: |
6300 6310 6320 6330 6340 6350
# 123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 6291 UGUGUCUUGGAUCGCGCGGGUCAAAUGUAUAUGGUUCAUAUACAUCCGCAGGCACGUAAUAAAGCGA=6357
% 6291 (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]]