 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
ORSV-S1_UPD1-PK3 |  |
|||
| PKB-number: | PKB58 |
| Definition: | Pseudoknot PK3 of the upstream pseudoknot domain (UPD1) of the 3'-UTR of odontoglossum ringspot virus, Singapore isolate |
| Organism: | odontoglossum ringspot virus |
| Abbreviation: | ORSV-S1_UPD1-PK3 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | U34586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J.Gen.Virol. 75:2851-2856. |
| Comment: | The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains (UPD1, UPD2 and UPD3, numbered from the 3'end). The UPD1 includes only PK2 and PK3; there is no homologue of PK1 (present in the UPD3). |
| Stem sizes: Loop sizes: |
4 5 5 0 6 |
| Position Paired: | 6473-6476; 6487-6490 6482-6485; 6499-6502 6486-6486; 6497-6497 |
| Bracket view of structure: |
6480 6490 6500
# 3456789|123456789|123456789|12
$ 6473 AGUGUUUGUCCCUCCACUUAAAUCGAAGGG=6502
% 6473 ((((:::::[[[[[))))::::::]:]]]]