 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_16S-PKcentre |  |
|||
| PKB-number: | PKB64 |
| Definition: | The central pseudoknot of 16S ribosomal RNA of E.coli |
| Organism: | E.coli |
| Abbreviation: | Ec_16S-PKcentre |
| RNA type: | rRNA |
| Keywords: | ribosome; translation; rRNA |
| EMBL number: | E05133 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Pleij C.W.A. et al. (1985). Nucleic Acids Res. 13:1717-1731.
[2] Poot R.A. et al. (1998). Nucleic Acids Res. 26:549-553. [3] Gutell R.R. (1993). Curr.Opin.Struct.Biol. 3:313-322. [4] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183. (database: http://rrna.uia.ac.be/ssu/) |
| Comment: | Initially suggested on the basis of phylogenetic comparisons [1], the central pseudoknot was shown to be important for ribosome functioning by mutagenesis [2]. The pseudoknot is also conserved in other 16S-like rRNAs: for review see e.g.[3], database on the small subunit ribosomal RNA [4]. |
| Stem sizes: Loop sizes: |
5 3 3 1 890 |
| Position Paired: | 9-13; 21-25 17-19; 916-918 |
| Bracket view of structure: |
10 20
# 123456789|123456789|123456(888)
$ 1 AAAUUGAAGAGUUUGAUCAUGGCUCA=26
% 1 ::::::::(((((:::[[[:))))):
920
#(888)56789|
$ 915 AUGAAU=920
% 915 :]]]::