 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_16S-PK505/526 |  |
|||
| PKB-number: | PKB65 |
| Definition: | The pseudoknot 505-507/524-526 of 16S ribosomal RNA of E.coli |
| Organism: | E.coli |
| Abbreviation: | Ec_16S-PK505/526 |
| RNA type: | rRNA |
| Keywords: | ribosome; translation; rRNA |
| EMBL number: | E05133 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Woese C.R. & Gutell R.R. (1989). Proc.Natl.Acad.Sci.USA 86:3119-3122.
[2] Powers T. & Noller H.F. (1991). EMBO J. 10:2203-2214. [3] Gutell R.R. (1993). Curr.Opin.Struct.Biol. 3:313-322. [4] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183. (database: http://rrna.uia.ac.be/ssu/) |
| Comment: | The pseudoknot was suggested on the basis of phylogenetic comparisons [1] and supported by mutagenesis [2] to be important for ribosome functioning. The pseudoknot is conserved in other 16S-like rRNAs: for review see e.g. [3], the database of small subunit rRNAs [4]. |
| Stem sizes: Loop sizes: |
3 7 3 6 7 |
| Position Paired: | 500-504; 541-545 505-507; 524-526 511-517; 534-540 |
| Bracket view of structure: |
500 510 520 530 540
# |123456789|123456789|123456789|123456789|12345
$ 500 GCACCGGCUAACUCCGUGCCAGCAGCCGCGGUAAUACGGAGGGUGC=545
% 500 ((((((((:::[[[[[[[::::::))):::::::]]]]]]])))))