 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Lp_PK2 |  |
|||
| PKB-number: | PKB68 |
| Definition: | Pseudoknot PK2 of Legionella pneumophila tmRNA |
| Organism: | Legionella pneumophila |
| Abbreviation: | Lp_PK2 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA |
| EMBL number: | U68079 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Williams K.P. & Bartel D.P. (1996). RNA 2:1306-1310.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [3] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/tmRDB.html). |
| Stem sizes: Loop sizes: |
10 7 1 10 12 |
| Position Paired: | 149-151; 195-197 153-155; 191-193 160-163; 182-185 165-171; 210-216 |
| Bracket view of structure: |
150 160 170 180 190 200 210
# 9|123456789|123456789|123456789|123456789|123456789|123456789|123456
$ 149 GUUAAACCAUCACUGUGUACUGGCCAAUAAACCCAGUAUCCCGUUCGACCGAGCCCGCUUAUCGGUAU=216
% 149 (((:(((::::((((:[[[[[[[::::::::::)))):::::))):)))::::::::::::]]]]]]]