 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Lp_PK3 |  |
|||
| PKB-number: | PKB69 |
| Definition: | Pseudoknot PK3 of Legionella pneumophila tmRNA |
| Organism: | Legionella pneumophila |
| Abbreviation: | Lp_PK3 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA |
| EMBL number: | U68079 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Williams K.P. & Bartel D.P. (1996). RNA 2:1306-1310.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [3] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/tmRDB.html). |
| Stem sizes: Loop sizes: |
9 7 24 0 3 |
| Position Paired: | 225-226; 273-274 227-233; 265-271 258-261; 282-285 262-264; 278-280 |
| Bracket view of structure: |
230 240 250 260 270 280
# 56789|123456789|123456789|123456789|123456789|123456789|12345
$ 225 CGGUCAUAAGAGAUAAGCUAGCGUCCUAAUCUAUCCCGGGUUAUGGCGCGAAACUCAGGGA=285
% 225 (((((((((::::::::::::::::::::::::[[[[[[[))))))):)):::]]]:]]]]