 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
T4_gene32 |  |
|||
| PKB-number: | PKB74 |
| Definition: | Pseudoknot of the regulatory region of T4 bacteriophage gene 32 mRNA |
| Organism: | bacteriophage T4 |
| Abbreviation: | T4_gene32 |
| RNA type: | mRNA |
| Keywords: | autoregulation; bacteriophage |
| EMBL number: | J02513 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; NMR; Sequence comparison; Structure probing; UV-hyperchromicity |
| References: |
[1] Qiu H. et al. (1996). Biochemistry 35:4176-4186.
[2] Theimer C.A. et al. (1998). J. Mol. Biol. 279:545-564. |
| Stem sizes: Loop sizes: |
4 7 1 0 5 |
| Position Paired: | 277-280; 289-292 282-288; 298-304 |
| Bracket view of structure: |
280 290 300
# 789|123456789|123456789|1234
$ 277 UGCCAGCUAUGAGGUAAAGUGUCAUAGC=304
% 277 ((((:[[[[[[[)))):::::]]]]]]]