 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
T2_gene32 |  |
|||
| PKB-number: | PKB73 |
| Definition: | Pseudoknot of the regulatory region of bacteriophage T2 gene 32 mRNA |
| Organism: | T2 bacteriophage |
| Abbreviation: | T2_gene32 |
| RNA type: | mRNA |
| Keywords: | autoregulation; bacteriophage |
| EMBL number: | X12460 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; NMR; Sequence comparison; UV-hyperchromicity |
| References: |
[1] Du Z. et al. (1996). Biochemistry 35:4187-4198.
[2] Du Z. & Hoffman D.W. (1997). Nucleic Acids Res. 25:1130-1135. [3] Nixon P.L. & Giedroc D.P. (1998). Biochemistry 37:16116-16129. |
| Comment: | The identical pseudoknot is folded in the regulatory region of T6 bacteriophage gene 32 mRNA [2]. |
| Stem sizes: Loop sizes: |
5 7 1 0 7 |
| Position Paired: | 2-6; 15-19 8-14; 27-33 |
| Bracket view of structure: |
10 20 30
# 123456789|123456789|123456789|123
$ 1 CUGACCAGCUAUGAGGUCAUACAUCGUCAUAGC=33
% 1 :(((((:[[[[[[[))))):::::::]]]]]]]