 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_S15 |  |
|||
| PKB-number: | PKB72 |
| Definition: | Pseudoknot of the regulatory region of S15 ribosomal protein mRNA |
| Organism: | E.coli |
| Abbreviation: | Ec_S15 |
| RNA type: | mRNA |
| Keywords: | translation; |
| EMBL number: | J02638 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Structure probing; 3D-modelling |
| References: | [1] Philippe C. et al. (1995). Nucleic Acids Res. 23:18-28. |
| Stem sizes: Loop sizes: |
10 7 1 0 31 |
| Position Paired: | 91-94; 116-119 96-101; 110-115 103-109; 151-157 |
| Bracket view of structure: |
100 110 120 130 140 150
# 123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 91 GGGAUCGCUGAAUUAGAGAUCGGCGUCCUUUCAUUCUAUAUACUUUGGAGUUUUAAAAUGUCUCUAA=157
% 91 ((((:((((((:[[[[[[[)))))))))):::::::::::::::::::::::::::::::]]]]]]]