 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_alpha |  |
|||
| PKB-number: | PKB71 |
| Definition: | Pseudoknot of the regulatory region of the alpha ribosomal protein operon |
| Organism: | E.coli |
| Abbreviation: | Ec_alpha |
| RNA type: | mRNA |
| Keywords: | translation; double pseudoknot |
| EMBL number: | X02543 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; calorimetry, UV hyperchromicity |
| References: |
[1] Tang C.K. & Draper D.E. (1989). Cell 57:531-536.
[2] Gluick T.C. & Draper D.E. (1994). J. Mol. Biol. 241:246-262. [3] Gluick T.C. et al. (1997). J. Mol. Biol. 270:451-463. |
| Stem sizes: Loop sizes: |
12 8 4 8 4 1 26 11 |
| Position Paired: | 144-150; 191-197 152-156; 186-190 165-168; 233-236 173-176; 224-227 181-184; 248-251 |
| Bracket view of structure: |
150 160 170 180 190 200
# 456789|123456789|123456789|123456789|123456789|123456789|123
$ 144 UGUGCGUUUCCAUUUGAGUAUCCUGAAAACGGGCUUUUCAGCAUGGAACGUACAUAUUAA=203
% 144 (((((((:(((((::::::::[[[[::::[[[[::::{{{{:))))))))))))::::::
210 220 230 240 250
# 456789|123456789|123456789|123456789|123456789|1
$ 204 AUAGUAGGAGUGCAUAGUGGCCCGUAUAGCAGGCAUUAACAUUCCUGA=251
% 204 ::::::::::::::::::::]]]]:::::]]]]:::::::::::}}}}