 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMV-L_UPD-PK2 |  |
|||
| PKB-number: | PKB83 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the tomato strain of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | TMV-L_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | X02144 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 6226-6228; 6236-6238 6230-6235; 6242-6247 |
| Bracket view of structure: |
6230 6240
# 56789|123456789|12345678
$ 6225 ACGUGGUACGUACGAUAACGUACA=6248
% 6225 :(((:[[[[[[))):::]]]]]]: