 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSBV1_UPD-PKc |  |
|||
| PKB-number: | PKB115 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA1 |
| Organism: | beet soil-borne virus |
| Abbreviation: | BSBV1_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | furovirus; pomovirus |
| EMBL number: | Z97873 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 5637-5639; 5647-5649 5641-5646; 5653-5658 |
| Bracket view of structure: |
5640 5650
# 6789|123456789|123456789
$ 5636 CGGUAGCGCGAACCUUAUCGCGCA=5659
% 5636 :(((:[[[[[[))):::]]]]]]: