 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ3_UPD-PKb |  |
|||
| PKB-number: | PKB114 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 3 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ3_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223598 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
4 6 4 0 6 |
| Position Paired: | 2351-2354; 2365-2368 2359-2363; 2377-2381 2364-2364; 2375-2375 |
| Bracket view of structure: |
2350 2360 2370 2380
# |123456789|123456789|123456789|12
$ 2350 UAGUGUUUACCGUUCCACUUAAAUCGAAACGGA=2382
% 2350 :((((::::[[[[[[))))::::::]:]]]]]: