 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ3_UPD-PKc |  |
|||
| PKB-number: | PKB113 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 3 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ3_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223598 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 2329-2331; 2339-2341 2333-2338; 2345-2350 |
| Bracket view of structure: |
2330 2340 2350
# 89|123456789|123456789|1
$ 2328 UCGUGGUGCAUACGAAAAUGCAUA=2351
% 2328 :(((:[[[[[[))):::]]]]]]: