 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ2_UPD-PKb |  |
|||
| PKB-number: | PKB112 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 2 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ2_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223597 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
4 6 4 0 6 |
| Position Paired: | 2737-2740; 2751-2754 2745-2749; 2763-2767 2750-2750; 2761-2761 |
| Bracket view of structure: |
2740 2750 2760
# 6789|123456789|123456789|12345678
$ 2736 UAGUGUUUUUCGUUCCACUUAAAUCGAAACGAU=2768
% 2736 :((((::::[[[[[[))))::::::]:]]]]]: