 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ2_UPD-PKc |  |
|||
| PKB-number: | PKB111 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 2 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ2_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223597 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 2715-2717; 2725-2727 2719-2724; 2731-2736 |
| Bracket view of structure: |
2720 2730
# 456789|123456789|1234567
$ 2714 ACGUGGUGCAUACGUUAAUGCAUA=2737
% 2714 :(((:[[[[[[))):::]]]]]]: