 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ1_UPD-PKb |  |
|||
| PKB-number: | PKB110 |
| Definition: | Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 1 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ1_UPD-PKb |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223596 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
4 6 4 0 6 |
| Position Paired: | 5826-5829; 5840-5843 5834-5838; 5852-5856 5839-5839; 5850-5850 |
| Bracket view of structure: |
5830 5840 5850
# 56789|123456789|123456789|1234567
$ 5825 UAGUGUUUGCCGUUCCACUUAAAUCGAAACGGA=5857
% 5825 :((((::::[[[[[[))))::::::]:]]]]]: