 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BVQ1_UPD-PKc |  |
|||
| PKB-number: | PKB109 |
| Definition: | Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 1 |
| Organism: | beet virus Q |
| Abbreviation: | BVQ1_UPD-PKc |
| RNA type: | Viral 3 UTR |
| Keywords: | pomovirus |
| EMBL number: | AJ223596 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036. |
| Stem sizes: Loop sizes: |
3 6 1 0 3 |
| Position Paired: | 5804-5806; 5814-5816 5808-5813; 5820-5825 |
| Bracket view of structure: |
5810 5820
# 3456789|123456789|123456
$ 5803 UUGUGGUGCAUACAAUAAUGCAUA=5826
% 5803 :(((:[[[[[[))):::]]]]]]: